billiejochaplin7225 billiejochaplin7225
  • 01-09-2018
  • Mathematics
contestada

Miguel bought 2 1/4 pounds of hamburger and 1 1/5 pounds if turkey and 2 pounds of cheese the total weight is?

Respuesta :

kenzierosa
kenzierosa kenzierosa
  • 01-09-2018

Hello! That would make a huge sandwich! ;) The answer I got is 2.7, BUT that made zero since with what you gave so I added it all back up again and your answer should be 5.45 pounds. Hope this helps!

Answer Link

Otras preguntas

crystal lattice definition
Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36
What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!
Help with these 4 questions please and thanks!!! 1. Find the radius of the circle x2 + 8x - 4 + y2 + 2y = 12 A. 9 B. 3 C. 5 D. 25 2. Find the center and radius
Many assume that presidents with high __________ are more effective leaders.
Which phrase states a principle that was part of president woodrow wilson's fourteen points?
Can someone please help me with numbers 1, a, b, c, 2, a, b, c
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
who invented the theory of relativity
what is the value of the expression i × i²× i³× i⁴