tiffany2842
tiffany2842 tiffany2842
  • 02-01-2019
  • Mathematics
contestada

need help asap please

need help asap please class=
need help asap please class=

Respuesta :

doomsday30 doomsday30
  • 02-01-2019
y=10(x)
for first he got 30 and on second he got 70
Answer Link

Otras preguntas

Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
How did the mountains in Greece contribute to the rise of city-states?
Companies raise funds to expand their business by
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
Help pl0x, Algebra 1
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The