brandyjune7230 brandyjune7230

03-01-2019
Mathematics

contestada

In 2 months mica spent a total of 305.43 on groceries she spent 213.20 in the first month how much did she spend in the second month

Respuesta :

lily9211 lily9211

03-01-2019

Answer:

$92.23

Step-by-step explanation:

If she spent 213.20 in the first month and Mica's total only counts for two months, then you can subtract 213.20 from 305.43 to see how much she spent in the second month.

305.43 - 213.20 = 92.23

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

A copper solution is light blue. The Cu(NH3)4 2+ ion is deep blue. What chemical is added to produce another color on the right

Write the linear equation in Slope intercept form for a slope of 5/2 and a y- point intercept of 3

conditioning explains why some people desire money even more than the objects that it purchases. A) Complex B) First-order C) Basic D) Second-order

Can anyone help me? Please??

The function y = 10 + 2.25(x - 4) can be used to determine the cost in dollars for a taxi ride of x miles. What is the rate of change of the cost in dollars wi

what is the boyles law of mass?

Please help this need to be turned in today

What is 11 more than n in an algebraic expression?

PLZ HELP! If given the following Graph:Andre earns $4000 a month at his new job. In order to track his spending and saving, he created a monthly budget. Andre d