rnava23 rnava23
  • 01-04-2019
  • Biology
contestada

cells are productd through what stage

Respuesta :

summernightslive summernightslive
  • 01-04-2019

You're either looking for Mitosis or Cytokinesis.

Mitosis. The stages that a cell goes through to divide.

Cytokinesis. The final cellular division to form two new cells.

Answer Link

Otras preguntas

Which are barriers to seeking mental health treatment? Check all that apply. feeling embarrassed having health insurance dealing with peer pressure having limit
. Find the approximate length of the hypotenuse of a right triangle with leg lengths 8.4 cm and 7.6 cm. 4.00 cm 7.99 cm 5.66 cm 11.33 cm
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
please answer this im dying here
Which weighs more? a.they both weight exactly the same. b.four protons c.two neutrons and two protons in a helium nucleus?
Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.
Which of the following best describes the rights given to the citizens of Jamestown by the Virginia Charter of 1606?
Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho
(50)points 5 questions!
-( x + 4 ) = 2x + 35