castillobelinda54 castillobelinda54
  • 01-04-2020
  • Mathematics
contestada

12x+ 1/3 = 10/3
what’s the equation

Respuesta :

Schoolacct7605
Schoolacct7605 Schoolacct7605
  • 01-04-2020

Answer:

Isolate the variable by dividing each side by factors that don't contain the variable.

Exact Form:

x = 14

Decimal Form:

x =0.25

Answer Link

Otras preguntas

Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.
The moon can always be seen from every part of the earth. This is a(n) ____________statement. a. Qualified c. Neither of these b. Absolute d. Both of these
why are the hindlimbs important on the frog
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Carbohydrates are an important macronutrient for fueling muscles. during exercise, where can the body obtain carbohydrate?
which goal stated in the preamble to the u.s. constitution requires a strong army
Which of the following do scientists think will probably cause Earth's next ice age?
The Hellenistic age was characterized by all of the following EXCEPT
If you take in fewer calories than you need you have a what energy balance
an equilateral triangle has perimeter 18 inches. what would be the perimeter of a square whose sides each measure the same length as the side of the triangle?