sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

How many solutions are there to the following system of equations? 4x – 14y = 6 –2x + 7y = –3 A. 1 B. 2 C. infinitely many D. 0

Which are key teachings or characteristics of both Hinduism and Buddhism? Choose all answers that are correct. A. Souls are reborn many times in reincarnation.

What do you think is Pericles greatest accomplishment

what does at least and at most mean?

need help with math's home work 1 - increase 235 by 27% 2 - increase 24g by 9% 3 - decrease 1120 of 13.5% 4 - decrease 0.057 by 55% sally investment of £450 has

Jorge friend Anna planted a garden with the same ratio of tulips to daises Anna garden has 48 tulips how many tulips and daises does Anna have this pic is for J

What two factors affect the rate of acceleration of an object?

the sum of three consecutive odd numbers is 81. what is the smallest of the three number?

What is the degree of comparison of the underlined modifier? Suzanne is a gifted ballet dancer. A. superlative B. positive C. comparative

Describe three properties of a frozen fruit bar including its state of matter.