emilyadese3
emilyadese3 emilyadese3
  • 04-06-2020
  • Mathematics
contestada

How do I do this?
I really need help and I don’t understand

How do I do this I really need help and I dont understand class=

Respuesta :

giftyagana750
giftyagana750 giftyagana750
  • 04-06-2020

Answer:

I think its a trapezium

area of trapezium= 1/2×(sum of parallel sides) ×height

1×(28+26)×18

2

1/2×54×18

54×9

= 586 km²

hope it helps

Answer Link

Otras preguntas

how many moles of NaCl are equivalent to 15.6g NaCl
Which molecule carries the instructions for producing mrna? a. trna b. dna polymerase c. dna d. rna polymerase?
Many assume that presidents with high __________ are more effective leaders.
the mammalian heart has: a. 4 chambers b. 2 chambers c. a two-sided muscular pump d. four-sided muscular pump e. a and c f. b and d
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Describe the set of data {33, 35, 38, 44, 45, 45, 46, 46, 46, 47}. a. normal distribution c. cannot be determined b. negatively skewed d. positively skewed
can you guys help me with this simple math problem ?
Public opinion in the united states tends to be more _____________ than political elites in areas such as religion in public schools, but more ______________ in
2x + 3y = 144x + 6y = 28 Which statement about the pair of equations is true?
what is r in this equation? πr^2=42π