sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

What is an embargo and who did the opec direct it towards

The perimeter of a rectangle is 34 m. The base is two times more than two times the height. What is the length of the base?

What were the differences in industrialization between Europe and the United States and Japan

The conservation of energy is a _______ because it is has been demonstrated without exception under certain stated conditions. A. scientific theory B. s

Turner Field · Georgia State and Georgia Tech dormitories · Stone Mountain Tennis Center · Wolf Creek Shooting Complex These things share which item?

The answer to the question

Based on what you learned in lesson 1, ideas such as where thunder comes from and why snow falls can be explained by what type of creative story? Question 1 o

i need help ! asap !

a recipe calls for 2 2/4 cups of raisins,but Julie only has a 1/4 measuring cup. how many 1/4 cups does Julie need to measure out 2 and 2/4 cups of raisins

What is the answer to both of these