ibrahim719 ibrahim719

01-11-2020
Mathematics

contestada

write the following numbers in standard form A 0.0000254 B 425100000

Respuesta :

possibility568 possibility568

01-11-2020

2.54x10^5 and 4.251x10^-8

Answer Link

AayushTripathy AayushTripathy

01-11-2020

Answer:

A ) 2.54 * [tex]10^{-5}[/tex]

B ) 4.251 * [tex]10^{8}[/tex]

If my answer helped, kindly mark me as the brainliest!!

Thank You!!

Answer Link

Otras preguntas

Why silk is called queen of fiber?

[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?

Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1

Sancho Panza is the farmer who acts as Quixote's 1._______. When Quixote attacks a 2.______ in the passage, Panza him 3_______. the choices for these are 1.co

Describe why plant cells are rigid:

How many positive odd integers less than 300 can be formed using the digits 0, 1,2,3,4?

The moon can always be seen from every part of the earth. This is a(n) ____________statement. a. Qualified c. Neither of these b. Absolute d. Both of these

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Throughout most of the war, southern forces suffered from a chronic shortage of food and supplies. a. True b. False

What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!