rrucker4704 rrucker4704
  • 03-12-2020
  • Spanish
contestada

can someone help, pleaseee

can someone help pleaseee class=

Respuesta :

duquesake0589 duquesake0589
  • 03-12-2020
Veronica es más linda que Lupe
El abrigo es más feo que los pantalones
Las galletas son más dulces que el pastel
Mi casa es más grande que la casa de Gloria
Vicente come más rápido que Pedro
Answer Link
purpleorange124
purpleorange124 purpleorange124
  • 03-12-2020

Answer:

1. veronica is bonito than lube.

the dulce is feo than the pants.

3.the la golleto is dulce than the el pastel.

4.my casa is grande than Glorias casa

5vince eats rapido than Pedro

Explanation: i did my best

Answer Link

Otras preguntas

The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
how to i do 7/16÷(31/2÷1/2)
p(x) x^3+x^2-x-1 Find all zeros of p (x)
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
does radiation need a phase of matter to travel with?
four yardequal Blank feet
Explain who or what "Año Viejo" is and its significance.
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?