odeyristh15 odeyristh15
  • 04-01-2021
  • Mathematics
contestada

Can someone help me thank you

Can someone help me thank you class=

Respuesta :

22nlin
22nlin 22nlin
  • 04-01-2021

Answer:

A)The function is negative when x is less than 0

Step-by-step explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the least common multiple of the pair of polynomials. 2y^2-32 and y+4
From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.
What is the density of a liquid that has a volume of 20.0 ml and a mass of 330 grams?
PLEASE HELP!! What was the 90-day wage and price freeze? A) a temporary freeze on wages, prices, and rents B) a sale to help the economy C) a
Name a few important body functions that your nervous system controls on its own without you having to think about it much?
What did president wilson's wife make sure was on the white house lawn?
Raquel recently received a poor grade on a school assignment. Her mother has noticed that Raquel is staying up late at night and hides in her room. Raquel is re
Can someone Help me with that please
Why is it important for scientists to use blind tests?