Jorge0718 Jorge0718
  • 12-02-2021
  • Mathematics
contestada

What’s the scale factor?

Whats the scale factor class=

Respuesta :

leamanda006 leamanda006
  • 12-02-2021
A scale that multiplies the quantity you can right it as a proportion or fraction
Answer Link

Otras preguntas

What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
in what area of Europe were the majority of warsaw pact countries
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God