zakleahyschool zakleahyschool

03-03-2021
Mathematics

contestada

Find the equation of the line that passes through (3,-4) and is parallel to
3x + y + 2 = 0
.
Leave your answer in the form y = mx + c

Respuesta :

03-03-2021

y = mx + b
add y to both sides:
3x + y - y + 2 = y
3x + 2 = y
y = 3x + 2

slope = 3x

m = 3 and (x, y) = (3, -4)
y + 4 = 3(x - 3)
y = 3x - 9 - 4
therefore, y = 3x - 13

Answer Link

coughtrey01 coughtrey01

03-03-2021

It would be this Y=3x-13

Answer Link

Otras preguntas

Find the x and y. Round answer to nearest tenth

Selected-Response A tomato sauce recipe uses 96 ounces of crushed tomatoes. How many pints of crushed tomatoes are needed to make the tomato sauce? (32 ounces =

Divide and answer in simplest form: 6 ÷ 4 3

TAKE ANY UNMARKED BOWL OR GLASS AND FILL IT EXACTLY 3/5 FULL WITH WATER. It has to be EXACTLY 3/5 full, so you can't guess or "eyeball" it. How are you going to

During the civil war, women in both the South and North served as

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Plant cells undergo photosynthesis to produce glucose, a visible form of chemical energy. The energy produced by plants becomes the base of an energy pyramid.

Solve for x. 3^2x= 15 (Type an integer or decimal rounded to the nearest tenth as needed.)

someone help me out pleasee

what is the answers for 2.9 × 4.5