Seudónimo Seudónimo
  • 02-04-2021
  • Mathematics
contestada

Help please I don’t understand how to do this

Help please I dont understand how to do this class=

Respuesta :

aaravmir
aaravmir aaravmir
  • 02-04-2021

Answer:

31.5

Step-by-step explanation:

let x = bars that jamie gets

x + x + 8 = 55

2x = 47

x = 23.5

Tyler = 23.5 + 8

        = 31.5

therefore tyler gets 31.5 bars

Answer Link

Otras preguntas

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10
What are two lines that intersect to form right angles called
The power P produced by a wind turbine is directly proportional to the cube of the wind speed S. A wind speed of 37 miles per hour produces a power output of 75
What are three conditions that can cause chemical reactions to occur?
find an equation of the line that passes through the point (1,-2) and is parallel to the line passing through the point (-2,-1) and (4,3)
In which way does the number of neurons affect the mass and stability of the nucleus
2y^3 • 3xy^3/3x^2 y^4
simplify the following: 3x(-2x^2+x-4)​
A bicycle wheel has a diameter of 64cm. What is the radius of the bicycle wheel?A) 64/πB)48C)33.3D)32​
5. The local readers’ club has a set of 49 hardback books and a set of 21 paperbacks. Each set can be divided equally among the club members. What is the greate