jacksongrow
jacksongrow jacksongrow
  • 01-07-2021
  • Mathematics
contestada

Which correctly completed the statement given below?

Which correctly completed the statement given below class=

Respuesta :

jerpar8111
jerpar8111 jerpar8111
  • 01-07-2021
I haven’t did one of theses in forever but I thinks its C
Answer Link
JoyMark
JoyMark JoyMark
  • 01-07-2021

Answer:

C = <CDB, SAS

You can prove side BD because of the reflexive property (using two of the same sides to prove something) and you are given the other side and the angle. So, since you have a side, angle, and side in that order, you can prove it with SAS.

Answer Link

Otras preguntas

"The Boy in the Striped Pajamas" is an example of which type of literature? Group of answer choices Fable Memoir Biography Speech
During the 1800's the United States acquired huge amounts of land through several land acquisitions that stretched its border from the Atlantic Ocean to the Pac
To the people who are struggling with schoolwork right now. Remember "Home is not a place to do schoolwork." But, fr take a break! If you answer you get 100 poi
Please help me with this homework
A $240.00 item is marked down by 25%. What is the new cost of the item? Round to two decimals if needed. $
Pls help I gat no idea :/
helpChoose the clincher sentence that best restates the following topic sentence.There are many fun things a person can do to help the brain.A.One thing that co
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Somebody pls help me!!!
mathematics for basic 4​