zg9xq9cpv4 zg9xq9cpv4
  • 02-10-2021
  • Mathematics
contestada

What number is 28% of 15

Respuesta :

bmeans048
bmeans048 bmeans048
  • 02-10-2021

Answer:

4.2

Step-by-step explanation:

Yes

Answer Link

Otras preguntas

In which sentence does the underlined noun clause function as the object of a preposition. Our group sends whoever requests information a newsletter and a link
What was one of the two major goals that the national organization for women work towards when it was first founded?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
accounting i know that when there's two panels its debit and credit but what is the third for what is each one
Yahaira is ready to reach the next level in her fitness. She is in great shape, but she still lacks the power needed to lift heavy objects. Which of the followi
An element's atomic number is 64. How many protons would an atom of this element have?
The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side
A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa
How have terrorism and the 9/11 attacks changed the policies of the United States in regards to immigrants and terrorism? Discuss the events of 9/11 and the War
In the Chinese civil war 1945-1949 support for Mao Zedongs communist forces came primarily from the