mollyjulianab mollyjulianab

04-01-2022
Mathematics

contestada

Expand and simplify 2(5x - 1) – (2x - 5)

Respuesta :

probity probity

04-01-2022

Answer:

2(5x - 1) – (2x - 5)

=2(5x−1)−2x+5

=10x−2−2x+5

=(10x−2x)+(−2+5)

=8x+3

Step-by-step explanation:

Answer Link

Otras preguntas

1/2x + 6 = -2 Plz help

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

What is the most common phrase used in French?

What happened when two fruit companies merged?

You have 500 mL of a 4.00 M solution of KNO3 from a previous experiment, but now you need 250 mL of a 0.500 M concentration of the same solution. How much of th

Use the confidence level and Sample data to find the margin of error E. Round your answer to the same number of decimal places as the sample mean unless otherwi

Which aspect of the US Constitution applies when a federal court overrides a state law? a. necessary and proper clause b. supremacy clause c. First Amendment d.

7. A flash light bulb is labeled to use 1.22 A and its resistance is 1.30 1. What voltage is the light bulb rated for?

10. What would happen to the food web if all the plants were removed?

What is the property of 16-3 and 3-16