jenniferherrera01 jenniferherrera01
  • 04-03-2022
  • English
contestada


What is most closely the meaning of rendered as it is used in the
passage below (lines 4-11)

Respuesta :

davisnk098
davisnk098 davisnk098
  • 04-03-2022

Answer:

what dose the passage say

Explanation:

Answer Link
Smartone5789
Smartone5789 Smartone5789
  • 04-03-2022
We need more info???
Answer Link

Otras preguntas

Which of the following is not a characteristic of African music? A. A wide range of indigenous instruments B. Strong harmonic structures C. Complex rhyt
Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.
What is the domain of the this function?
A 2000 calorie diet in which carbohydrate provides 50% of the calories would provide how many grams of carbohydrate?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the absolute maximum and minimum values of the function f(x, y) = x2 + xy + y2 on the disc x2 + y2 ≤ 1. (you do not have to use calculus.)
The stroop effect demonstrates people's inability to ignore the ______ of words.
Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.
A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil
How many grams of potassium hydroxide are needed to prepare 600 ml of a.450 m koh solution?