jlterryjlterry9367 jlterryjlterry9367
  • 02-04-2022
  • SAT
contestada

A chair has a mass of 10 kilograms on earth. What is the mass of the chair on mercury?

Respuesta :

zhiwenc12
zhiwenc12 zhiwenc12
  • 02-04-2022

Answer:

The mass of the chair is 10kg.

Explanation:

The Mass of an object is unaffected by gravity. The Weight of an object is affected by gravity.

Answer Link

Otras preguntas

One of the benefits that the gi bill of rights offered to returning veterans was
PLEASE HELP ASAPPPPPP An advertiser rents a rectangular billboard that is 44 ft wide and 20 ft tall. The rent is $15 per square foot. For a billboard twice as t
_______________ exposure to radiation can increase the risk of cancer.
14. Find the coordinates of the circumcenter for ∆DEF with coordinates D(1,3) E (8,3) and F(1,-5). Show your work.
which statement about nuclear fusion is correctA) Two hydrogen electrons become protons during fusion B) Helium nuclei xan fuse to form electrons such as nitrog
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Personal care quiz---when providing nail care it is important to consult a professional true or false
the influence of Greek and Roman culture on some Renaissance art is reflected in what
what are the zeros of the function? f(x)=+-6x
which of the following statements agrees with the second law of thermodynamics