dontmindthisemailsoy dontmindthisemailsoy

01-05-2022
Mathematics

contestada

please please please help me with these four questions! giving brainly!!

please please please help me with these four questions giving brainly class=

Respuesta :

ESLearner ESLearner

01-05-2022

Answer:

Step-by-step explanation:

Ver imagen ESLearner

Answer Link

Otras preguntas

The dodecahedron can be constructed from the repetitive folding of _____. A. equilateral triangles B. squares C. triangles D. regular pentagons

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

An element's atomic number is 64. How many protons would an atom of this element have?

Find the area bounded by the curves x = y2 - 4y and x = 2y - y2. Your work must include an integral in one variable.

We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church

Studies of populations that reveal correlations between dietary habits and disease incidence are

The long-reigning absolutist king of france, __________, portrayed himself as the "sun king."

Cells that can divide indefinitely, renew themselves, and give rise to a variety of other types of cells are called _____ cells.

Simplify the expression completely. x squared over x to the power of 6

HELP FAST PLEASE Juan drew a right triangle with leg length of 6 centimeters and 8 centimeters he wants to draw another triangle that is similar to the first on