emilybb195
emilybb195 emilybb195
  • 02-02-2017
  • Mathematics
contestada

someone please help !!! picture shown

someone please help picture shown class=

Respuesta :

jeronica31 jeronica31
  • 02-02-2017
your answer should be true
Answer Link
xphenomx
xphenomx xphenomx
  • 02-02-2017
The answer would be false because g(x) fails the horizontal line test. If there is more than one x-value for the same y-value, it fails the horizontal line test and therefore does not have an inverse function.
Answer Link

Otras preguntas

If the area of a square is 32 ft2, how long is its diagonal?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Tick the option that shows how the words 'where my nan lives' are used in the sentence. On holiday, we drove through the village where my nan lives. 1)as a rela
A solution is select one: a. nonuniform. b. homogeneous. c. heterogeneous.
the length of a rectangle is twice its width. If the area of the rectangle is 50 ft ^2, find its perimeter.PLEASE HELP!!!!!!!!REALLY IMPORTANT HAVE TO FINISH MY
During the cross-bridge cycle, after the calcium binds to troponin, what happens next?
Find the length of the missing side of a right triangle if a=6 and c=11
If a family has three children, what is the probability that the family has at least one girl?
What will be the value in twenty years of $1000 invested at the end of each year for the next twenty years?
what was considered an act of war in 1914?