jeffersonliranz jeffersonliranz
  • 03-02-2017
  • Biology
contestada

Under what 2 types of plates is the oceanic lithosphere being subducted?

Respuesta :

Samarion889
Samarion889 Samarion889
  • 03-02-2017
Continental plates is one type and oceanic is the other type and together they work with the crust so confidently plate and crust
Answer Link

Otras preguntas

The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
How do you put allele in a sentence
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why did the french revolution happen and who's fault was it
A light bulb converts electrical energy into electromagnetic energy is true or false?
A light bulb converts electrical energy into electromagnetic energy is true or false?
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20