Za7baamanhayloookie Za7baamanhayloookie
  • 01-03-2017
  • Business
contestada

How do product characteristics influence packaging and materials handling considerations?

Respuesta :

xFoxMusic xFoxMusic
  • 01-03-2017

One consideration is a product’s physical characteristics; substances exist in three forms—solid, liquid, gas—and each form has specific packaging requirements.  For instance, metal cylinders are one method for the packaging of gases, while metal pails can be used for the packaging of liquids.

Answer Link

Otras preguntas

what is the geometric mean between 6 and 20?
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
how do you know 8 thousandths is less than 1 hundredths
where are the three parts of an atom located
what rule does static electricity follow
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5