princess1784 princess1784
  • 01-04-2017
  • Mathematics
contestada

The sum of two numbers is
61
. The larger number is
23
more than the smaller number. What are the numbers?

Respuesta :

sgilot262
sgilot262 sgilot262
  • 01-04-2017
23 and 38, I think .
Answer Link

Otras preguntas

a 1kg rock is at a height of 100 meters. What is the rocks gravitational potential energy at 100 meters high
The next question refers to This Mystery Rocks! by Cynthia Schlagel. The sentences have been numbered to help you identify them more easily. This Mystery Rocks!
Mikhael, Hema, and 5 friends will help run their school's fundraiser. They will wearINTERESTeither a red shirt or a red baseball cap during the event. They want
Max studies the same amount of time each day for 5 days for a socialstudies test. He also studies 45 minutes for a math quiz. He studied fora total of 300 minut
Help It Due TodayIn Brown v. Board of Education, the Supreme Court used the equal protection clause in the Fourteenth Amendment to declare educational segregat
which example best describes how an X-ray machine works? 20 A QUESTIONS O Switching a flashlight on and off to transmit a message 0 Removing the batteries from
Why is it unhelpful to compare your life to the lives others portray on social media?
help please I'd definitely appreciate it & stay safe & wash your hands .Solve the equation for x:-2x = 1/3
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
Your high school freshman class consists of 760 students. In recent years, only 4 out of 7 students actually graduated in four years. Approximately how many of