AnglaPirkey AnglaPirkey
  • 03-05-2015
  • History
contestada

The first battleground between those favoring the extension if slavery and those opposing it was where ?

Respuesta :

someone3 someone3
  • 03-05-2015
the battle of bull run was the first major battle of the civil war. the union had lost.
Answer Link

Otras preguntas

Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
testosterone directly affects the
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Why did the french revolution happen and who's fault was it
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how do you say theatre in Spanish
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
why is it critical to your cells to be near capillaries
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
What are the factors of 6x + 24?