zoeyanderson7654 zoeyanderson7654
  • 01-11-2017
  • Computers and Technology
contestada

How to do citations for comments on websites?

Respuesta :

Аноним Аноним
  • 07-11-2017
Instead of memmorizing MLA format for citations, which would be almost impossible bluh :(, I highly recommend EasyBib.com, It's a very user-friendly website, and all you have to do is copy your link into the citation bar, then it converts the publication into whatever format of citation you need. :) Hope this helps
Answer Link

Otras preguntas

the bombing of Hiroshima and Nagasaki resulted in
Round 46.895 to the nearest tenth
A generator stores electric current. Explain why you agree or disagree with this statement
How much money, in dollars, does one mole of nickels represent?
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
the perimeter of a square 116ft ?
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
What is the sum of 6/10 plus 7/12