bikerboykai bikerboykai
  • 01-11-2017
  • Mathematics
contestada

which is the longer length 29ft or 9 yards

Respuesta :

altavistard
altavistard altavistard
  • 01-11-2017
Convert 9 yards into feet:  9 yards * (3 feet) / (1 yard) simplifies to 27 feet.

9 yards, or 27 feet, is shorter than 29 feet.

29 feet is longer than 27 feet.

Answer Link

Otras preguntas

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
The graph of the piecewise function f(x) is shown. What is the domain of f(x)? Ty 7 6 5 {x|1 O {x|1 O {yl-4 sy< 1} Oy|-4sys 1} 4 3 2 1 1 3 4 5 -6 -5 -4 -3 -2
Whether you have your camera with you or not, the only way to learn about is to observe it constantly. A. shutter speed B. exposure C. composition D. light
100 points need help for unit test please!!! don't answer if you don't know question attached
I NEEEEDDD HELPPP PLZZ
After shooting the arrow at the pig, what was katniss' biggest fear?
which of these sentences uses pronouns correctly coventions and style
The rectangle below has an areas of x^2+8x+15 square metres and a width of x+3 meters what expression represents the length of the rectangle
I need help with #1
kon hai yaha abhi. . kaha phasa diya ​