jonathanforstouoynh jonathanforstouoynh
  • 03-12-2017
  • Mathematics
contestada

An investment of $450 increases at a rate of 6.5% per year. What is the growth factor, b?

Respuesta :

CS9537
CS9537 CS9537
  • 03-12-2017

1.think about it... if 75 out of 100 or 75/100 or 75% is in proportion than...

75/100 can be = 0.75 so if you convert that to the growth factorthen 6.5/100... does that help?


Answer Link
ericcaa66
ericcaa66 ericcaa66
  • 17-09-2018

example: if you have 10% of 100 it would be 0.10 so in this case. 6.5% is 0.65 if this makes any sense. so 0.65 is your answer

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Write expression using the distributive property to find the product of 7 times 63
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
Susan ........ (Run) to school because she was late.
the reproductive system of a male mammal provides
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
What are some methods used by Mussolini to rise to power?
Explain who or what "Año Viejo" is and its significance.