marktad2000 marktad2000
  • 02-02-2018
  • Mathematics
contestada

4.25 x +2(6.50)=5.95(x+2) solve for x

Respuesta :

dannielle
dannielle dannielle
  • 02-02-2018
4.25x+13=5.95x+11.9
5.95x - 4.25x=13 -11.9
1,7x=1,1
x=1.1/1.7
x=11/17
Answer Link
yellowyarn2003 yellowyarn2003
  • 02-02-2018
4.25x + 13 = 5.95x + 11.9
1.7x = 1.1
x = 11/17
x = .64
Answer Link

Otras preguntas

a trip to the ocean can be a relaxing escape from the everyday pressures of life. A Sailboat glistening on the horizon provides a mental escape to faraway place
if you work in an adolescent oncology youth cancer office will the doctor more likely see patients with Hodgkin lymphoma or neuroblastoma explain your answer
help me asap !!!!!!!!
A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle
Find the product. (7x-2) (x+y)
What is the end behavior of the function f(x) = −x3 + 2x2 + 4x + 5? A. Up on the left, up on the right. B. Up on the left, down on the right. C. Down on the lef
A number is increased by 50 percent, then the resulting number is decreased by 40 percent. What is the original number if the final number is eight less than th
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?
Which type of intelligence allows people to use their vision to develop mental images?