naansah8756 naansah8756

03-03-2018
History

contestada

What was the day like before the attack of pearl harbor?

Respuesta :

itswolfstein itswolfstein

06-03-2018

We weren't really involved in the war at all, it was like a normal day; but then pearl harbor came and as President Roosevelt quoted "a day that will live in infamy" this was the point where the U.S joined the war against Japan

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of the following Platonic solids is also a cube? a) lcosahedron b) hexahedron c) octahedron d) tetrahedron e) dodecahedron f) none of these

Adele earns about $15 each day in tips as a waitress. If she saves $7.50 of it, how many workings days will ot take her to save $225 ?

On a number line, let point p represent the largest integer value that is less than 407. le point q represent the largest integer value that is less than 68 − .

please answer this im dying here

^5sqrt4x^2 ^5sqrt4^2

Ully is having a party and wants to fill his swimming pool. if he only uses his hose it takes 2 hours more than if he only uses his neighbor's house. of houses

Abraham lincoln's and andrew johnson's reconstruction plans shared an emphasis on

Separation of ownership and control creates an agency problem when an agent pursues goals that conflict with the principals' goals. Principals establish and use

plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.