reevesjznna reevesjznna
  • 01-02-2016
  • English
contestada

The Dionysia was a religious festival honoring which Greek god?

Respuesta :

Аноним Аноним
  • 01-02-2016
The Dionysia was a religious festival honoring the Greek god Dionysus (hence the name). It was the second largest festival, after the Panathenaia, and the events were theatrical performances such as tragedies and comedies. Dionysus was the god of grape harvesting, wine-making, wine, religious ecstasy, fertility and ritual madness. 
Answer Link

Otras preguntas

List two ways plants have adapted to living in the desert.​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Which word best completes the sentence? In some cultures, it is considered _____________ to look down while an elder is speaking to you. a. respectful b. obedie
Solve for x help please
A scientific question you've always wanted to know
people go with my mett code yhv-ehoo-tji
How do a region’s natural resources shape its economy?
→ cultural diversity
- 8th Grade Work - Consider the following equation |x| = y. For any value of y, will there always be corresponding values for x? Explain. Help me please ; - ;
Please help. I don’t understand and don’t know what do to.