cuthbertson3766 cuthbertson3766
  • 04-05-2018
  • Biology
contestada

Tissue in the central canal of bone that consists chiefly of fat cells is called

Respuesta :

Bistai
Bistai Bistai
  • 13-05-2018

Yellow bone marrow is the tissue in the central canal of bone that consists chiefly of fat cells. Yellow bone marrow produces fat cells, cartilage, and bones. It acquires the yellow color by carotenoids in the fat droplets and it arises from the conversion of the red bone marrows which occurs with age.






Answer Link

Otras preguntas

Give a recursive algorithm for finding the sum of the first n odd positive integers.
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the temperature of a sample of matter is a measure of the ?
four yardequal Blank feet
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
How much money, in dollars, does one mole of nickels represent?
what is the lcd of 10/11,29/44
i need help with #3