abrahamrodriguez330 abrahamrodriguez330
  • 13-03-2020
  • Physics
contestada

A hypothesis is _______.

Respuesta :

dktorsergey
dktorsergey dktorsergey
  • 13-03-2020

Answer:

A hypothesis is a basically a theory proposed to a subject or refrence to an act with limited evidences.

Answer Link

Otras preguntas

Unit 8: Right Triangles & Trigonometry Homework 2: Special Right Triangles...Please Help!
Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG
For most products higher prices
why does it rains sometimes and not others?
An electric field around two charged objects is shown. Two spheres next to each other. Vectors perpendicular to each surface spread out and go to the other char
ooga booga googa nooga see ya
Over a 4.5 hour period, the rain gauge collected 2.8 inches of rain. In thenext 19.5 hours it collected an additional 1.75 inches of rain. What is thetotal amou
Examine the diagram of the carbon cycle shown above. Through which of the following processes is carbon removed from the atmosphere?
PARTE II: Comunicación y cultura A. Listen as these teens invite a friend to do something. At first, each friend declines the invitation. However, after asking
which statement must be true